Gene

Title: Pinus massoniana R2R3-MYB transcription factor (MYB1) mRNA, complete cds
Sequence ID: PM0001 Genbank Accession
Source organism: Pinus massoniana
Author(s): Ha Van Huan, Hoang Minh Trang, Tran Thi Hong Ha
Address: Viet Nam National University of Forestry, Ha Noi, Viet Nam
Project name: Level:
Published:
Gene name(or DNA fragment) MYB1 Size: 1023
Mol type: cDNA
CDS 1-1023 Size: 1023
Codon start: 1
Product: R2R3-MYB transcription factor
Function/Feature: Transcription factor
Nucleotide sequence
ATGGGGAGGCAACCGTGCTGTGACAAAGTGGGATTGAAGAAGGGTCCATGGACTGCAGAGGAAGACAGAAAACTGGTGAATTTTATCACCCTGCATGGCCATGGATGCTGGCGCGAAGTACCCAAACTTGCTGGTCTGCTTAGATGTGGCAAGAGCTGTAGATTGCGCTGGACAAATTACTTGCGCCCAGATTTGAAGCGTGGATTATTGTCTGAATCAGAAGAGAAGCTCATCATTGATCTACATGCTGCCATAGGGAATAGGTGGTCACGAATCGCTGCGCAATTGCCAGGGAGAACTGATAACGAGATCAAGAATTACTGGAACACGAGGATCAAGAAGAAACTGCGCCAGATGGGAATCGATCCTGTGACCCACAAGCCTCTCACCCAAATGCAAATGCAGAGCACCCCTGCGCAGACTCTGCTGCTGCAAGAAAATGATACAGAGCAGAAGCAGCAGGAGCAACATAATGAGCCTGATCCTGATCAGAATCAGAGCAGCAATGGCACTGTGGAGACATTGGTCTCGAGGGCGAGAGAACCCCACGACGACATAGAGCCTCTGCAGAATTTCAACATGGAGGATTCGAATTTTAACATGGAGGATTCGATGCAATTGTTCGATGTCTGCTCGCCCACCAGCGGGATAAGCCTGTCTGGGAGAACCGAGGAGGTCGATTCAGATGATTCTGATCAGGTCTCCAAGAGCTTCGGCAATGGCAGCAGTACCCATTCTCAGTACATTGGGCGAGAAAGCTCTGGTGTCGAGGCCGAATGTGGTTTGTCTGGTTGGGATCAGATGGCTGGCGTTTTGGGCGATCCCCTTTCTGAGTGGAATGTCGATTTGGAGTCCTGGGCTGCTGGATTGGATGCCCCTGCAGCCTCTGCCTCTGCATGGATTCAGCAGCTCCCTGACTGCCAATGGAACGACTTCCAGGGCGATTTTGAGATCTGCAGCAGCAAGTCATGTCCGGAGACTCTGCAGAGACTGGGGCCCTTTCTTGATGACGATGAATTGTGA
Amino acid sequence
MGRQPCCDKVGLKKGPWTAEEDRKLVNFITLHGHGCWREVPKLAGLLRCGKSCRLRWTNYLRPDLKRGLLSESEEKLIIDLHAAIGNRWSRIAAQLPGRTDNEIKNYWNTRIKKKLRQMGIDPVTHKPLTQMQMQSTPAQTLLLQENDTEQKQQEQHNEPDPDQNQSSNGTVETLVSRAREPHDDIEPLQNFNMEDSNFNMEDSMQLFDVCSPTSGISLSGRTEEVDSDDSDQVSKSFGNGSSTHSQYIGRESSGVEAECGLSGWDQMAGVLGDPLSEWNVDLESWAAGLDAPAASASAWIQQLPDCQWNDFQGDFEICSSKSCPETLQRLGPFLDDDEL