Gene

Title: Phaseolus vulgaris glycine rich protein (GRP1.8) gene, promoter region
Sequence ID: GQ383514 Genbank Accession
Source organism: Phaseolus vulgaris
Author(s): Thanh,N.V., Huan,H.V., Thao,T.T., Thang,B.V., Giang,H.V. and Ha,C.H.
Address: Viet Nam National University of Forestry, Ha Noi, Viet Nam
Project name: Level:
Published: VNU Journal of Science
Gene name(or DNA fragment) GRP1.8 promoter Size: 614
Mol type: DNA
CDS Size:
Codon start:
Product:
Function/Feature: Promoter
Nucleotide sequence
tgatggcactcttgaagccatatcaatggtaataagttaatttgagaagaattgttccatgcattcaaataatgctagcagtcttcactttttttacttaaatatcatcggtagtaaattaataaaatgttctatcttcctaatatatctagcgattaacaaatttataaaaaagaggtatgtttgcagttgcacccgatgatagtggtggcaataagaaaaaaaagggaagacagaaggaagaagaagattgagaaagtaaaatgcagtgcaaaatggtggtgagtgggaggtagaaaagagggataagataggtaggtgtgaaaaagaaaagaaaaaagcgtaggtttgttggagtagctagtgtatttgtatgggtactgcatgctccgttggatgtggaagacagcagaagcacacaatgaagctccagtatgagtggtttcagtgtatctttgtatgttggcataatgggccacactgtgggggcatccaactttcatatccatgtgcttcaaccactctttgctctcaacgcgccttcccaatccctataaatacccttcaagtctcctcacttcaaaaccaacctatttcagcttcacttcactctc
Amino acid sequence