Gene

Title: Pinus massoniana 4-coumarate:CoA ligase (4CL1) mRNA, complete cds
Sequence ID: FJ810495 Genbank Accession
Source organism: Pinus massoniana
Author(s): Huan,H.V., Thang,B.V. and Giang,H.V.
Address: Viet Nam National University of Forestry, Ha Noi, Viet Nam
Project name: Level:
Published: Mol. Breed. 29 (1), 173-180 (2012)
Gene name(or DNA fragment) 4CL1 Size: 1620
Mol type: mRNA
CDS 4..1617 Size: 1614
Codon start: 1
Product: 4-coumarate:CoA ligase
Function/Feature: Encoding for 4-coumarate:CoA ligase
Nucleotide sequence
gccatggccaacggaatcaagaaggtcgagcatctgtacagatcgaagcttcccgacatcgagatctccgaccatctgcctcttcattcgtattgctttgagagagtagcggaattcgcagacagaccctgtctgatcgatggggcgacagacagaacttatagcttttcagaggtggaactgatttctcgcaaggtcgctgccggtctggcgaagctcgggttgcagcaggggcaggttgtcatgcttctccttccgaattgcatcgaatttgcgtttgtgttcatgggggcctctgtccggggcgccattgtgaccacggccaatcctttctacaagccgggcgagatcgccaaacaggccaaggcggcgggcgcgcgcatcatagttacgctggcggcttatgttgagaaactggccgatctgcagagccacgatgtgctcgtcatcacaatcgatgatgctcccaaggaaggttgccaacatatttccgttctgaccgaagccgacgaaacccaatgcccggccgtgaaaatccacccggacgatgtcgtggcgttgccctattcttccggaaccacggggctccccaagggcgtgatgttaacgcacaagggcctggtgtccagcgttgcccagcaggtcgatggtgaaaatcccaatctgtatttccattccgaggacgtgatactctgcgtcttgcctcttttccacatctattctctcaattcggttctcctctgcgcgctcagagccggggctgcgaccctgattatgcagaaattcaacctcacgacctgtctggagctgattcagaaatacaaggttaccgttgccccaattgtgcctccaattgtcctggacatcacaaagagccccatcgtttcccagtacgatgtctcgtccgtccggataatcatgtccggcgctgcgcctctcgggaaggaactcgaagatgccctcagagagcgttttcccaaggccattttcgggcagggctacggcatgacagaagcaggcccggtgctggcaatgaacctagccttcgcaaagaatcctttccccgtcaaatctggctcctgcggaacagtcgtccggaacgctcaaataaagatcctcgatacagaaactggcgagtctctcccgcacaatcaagccggcgaaatctgcatccgtggacccgaaataatgaaaggatatattaacgacccggaatccacggccgcaacaatcgatgaagaaggctggctccacacaggcgacgtcgggtacattgacgatgacgaagaaatcttcatagtcgacagagtaaaggagatcatcaaatataagggcttccaggtggctcctgctgagctggaagctttacttgtggctcatccgtcaatcgctgacgcagcagtcgttcctcaaaagcacgaggagacgggcgaggttccggtggcgttcgtggtgaagtcatcggaaatcagcgagcaggaaatcaaggagttcgtggcaaagcaggtggttttctacaagaaaatacacagagtttactttgtggatgcgattccgaagtcgccgtccggcaagattctgagaaaggatttgagaagcagactggcagcaaaatgaaaa
Amino acid sequence
ANGIKKVEHLYRSKLPDIEISDHLPLHSYCFERVAEFADRPCLIDGATDRTYSFSEVELISRKVAAGLAKLGLQQGQVVMLLLPNCIEFAFVFMGASVRGAIVTTANPFYKPGEIAKQAKAAGARIIVTLAAYVEKLADLQSHDVLVITIDDAPKEGCQHISVLTEADETQCPAVKIHPDDVVALPYSSGTTGLPKGVMLTHKGLVSSVAQQVDGENPNLYFHSEDVILCVLPLFHIYSLNSVLLCALRAGAATLIMQKFNLTTCLELIQKYKVTVAPIVPPIVLDITKSPIVSQYDVSSVRIIMSGAAPLGKELEDALRERFPKAIFGQGYGMTEAGPVLAMNLAFAKNPFPVKSGSCGTVVRNAQIKILDTETGESLPHNQAGEICIRGPEIMKGYINDPESTAATIDEEGWLHTGDVGYIDDDEEIFIVDRVKEIIKYKGFQVAPAELEALLVAHPSIADAAVVPQKHEETGEVPVAFVVKSSEISEQEIKEFVAKQVVFYKKIHRVYFVDAIPKSPSGKILRKDLRSRLAAK